Phương pháp định tính bằng kỹ thuật Polymerase Chain Reaction

Salmonella trong sản phẩm thuỷ sản – Phương pháp định tính bằng kỹ thuật Polymerase Chain Reaction

1. Phạm vi áp dụng

Tiêu chuẩn này quy định phương pháp định tính Salmonella trong sản phẩm thuỷ sản bằng kỹ thuật Polymerase Chain Reaction (sau đây gọi tắt là PCR).

2. Tài liệu tham khảo

– Rapid Identification of Salmonella serovars in feces by specific detection of virulence gens, invA and spvC, by an Enrichment broth culture multiplex PCR combination assay. (CHENG HSUN CHIU AND JONATHAN T.OU. – Journal of Clinical microbiology, p.2619-2622. Oct. 1996).

– Specific detection of Salmonella spp. by multiplex polymerase chain reaction. (JS. WAY, KL. JOSEPHSON, SD. PILLAI, M. ABBASZADAGAN, CP. GERBA AND IL. PEPPER. – Appl. Environ. Microbiol., 59 (5) : 1473 – 1479, 1993).

– Detection of Salmonella spp. and Listeria monocytogenes in Suspended Organic Waste by Nucleic Acid Extraction and PCR. (CAROLA BURTSCHER, PAPA A. FALL, PETER A. WILDERER, AND STEFAN WUERTZ. – Appl. Environ. Microbiol. 65 (5): 2235 – 2237, 1999).

– Nordic commitees on food analysis (NMKL) No 71, 5th ed., 1999, Salmonella – Detection in foods.

3. Giải thích thuật ngữ

Trong Tiêu chuẩn này, các thuật ngữ dưới đây được hiểu như sau:

3.1 Salmonella

Giống Salmonella là vi sinh vật thuộc họ vi khuẩn đường ruột enterobacteriaceae có hơn 2400 kiểu huyết thanh. Salmonella là trực trùng Gram âm, kích thước khoảng 0,6 – 2,0 mm, hiếu khí, có thể di động, không tạo bào tử, sinh hơi lên men dextrosa, sinh khí đihyđrosunfua.

Tất cả các khiểu huyết thanh Salmonella đều mang cụm gen inv (invasion) giúp cho quá trình xâm nhiễm vào trong thành ruột của người và động vật, mở đầu của tiến trình gây bệnh. Cụm gen này nằm trong hệ thống gen SPI – 1 (Salmonella pathogenicity island) có mặt trong tất cả các Salmonella, từ nhóm tiến hoá thấp nhất là S. bongori đến nhóm tiến hoá cao nhất là S. enterica I. InvA là một bản gen luôn có mặt trong hệ thống gen inv.

3.2 Kỹ thuật PCR

Kỹ thuật PCR là kỹ thuật dùng để khuếch đại số lượng bản sao của một trình tự AND đích qua các chu kỳ gồm 3 bước: biến tính ADN, bắt cặp bổ sung với mồi và tổng hợp mạch mới nhờ enzym ADN polymerase.

3.3 ADN đích (target ADN)

Trong kỹ thuật PCR, ADN đích được hiểu là một đoạn ADN đặc trưng cho đối tượng cần phát hiện. Trong Tiêu chuẩn này, ADN đích là một đoạn trong gen invA.

3.4 Biến tính

Biến tính là sự chuyển từ sợi ADN dạng mạch kép sang dạng mạch đơn dưới tác dụng của tác nhân biến tính. Trong Tiêu chuẩn này, tác nhân biến tính là nhiệt.

3.5 Bắt cặp bổ sung

Bắt cặp bổ sung là sự kết hợp giữa hai mạch ADN hay một ADN mạch đơn với ARN có các trình tự bổ sung để tạo nên một mạch kép.

3.6 ADN polymerase

ADN polymerase là enzym tổng hợp nên mạch ADN mới từ một mạch khuôn. Phương pháp này sử dụng Taq ADN polymerase là một ADN polymerase hoạt động ở nhiệt độ cao.

3.7 Mồi

Mồi là một trình tự ADN hay ARN ngắn bắt cặp với một mạch khuôn ADN có mang một đầu 3′ – OH tự do giúp ADN polymerase bắt đầu tổng hợp mạch mới.

4. Nguyên tắc

Phương pháp định tính này dựa vào việc xác định đoạn ADN đích có được khuếch đại hay không. Quá trình xác định được thực hiện bằng cách điện di sản phẩm khuếch đại trên gel agarose, nhuộm màu ADN bằng etyl bromua và quan sát bằng đèn UV có bước sóng là 302 mm. Nếu trong mẫu có gen đích, trên bảng gel điện di sẽ xuất hiện sản phẩm khuếch đại có kích thước phù hợp với độ dài của đoạn ADN đích đã định. Nếu trong mẫu không có gen đích, trên gel diện di không xuất hiện sản phẩm khuếch đại hay sản phẩm khuếch đại có kích thước không phù hợp với đoạn ADN đích.

5. Thiết bị, dụng cụ, hoá chất và môi trường

5.1 Thiết bị, dụng cụ

5.1.1 Tủ ấm 37oC.

5.1.2 Máy luân nhiệt.

5.1.3 Máy ly tâm dùng cho ống eppendorf 1,5 ml.

5.1.4 Máy lắc ống nghiệm.

5.1.5 Thiết bị điện di ngang và bộ nguồn điện di có điện thế hoạt động từ 80 đế 150 volt.

5.1.6 Hộp đèn soi UV có kính lọc 302mm.

5.1.7 Bộ chụp ảnh trên đèn UV.

5.1.8 ống Eppendorf 0,2. 0,5 ml; 1,5 ml chuyên dùng cho PCR.

5.2 Hoá chất, môi trường

5.2.1 Mồi

Gồm hai mồi invA1 và invA2 được thiết lập cách nhau 520 bp trong gen invA có vai trò trong quá trình xâm nhiễm Salmonella vào thành ruột động vật và người. Trình tự của hai mồi như sau :

invA1 : 5′ – TTGTTACGGCTATTTTGACCA -3′

invA2 : 5′ – CTGACTGCTACCTTGGCTGATG – 3′

Nồng độ mồi sử dụng trong phân tích được pha loãng thành 6 pM trong đệm TE. Ðệm TE có thành phần như sau : 10 mM Tris-HCl (pH = 8), 1 mM EDTA.

5.2.2 Môi trường nuôi cấy vi sinh vật và các loại hoá chất khác

Khuyến khích sử dụng môi trường nuôi cấy dạng bột khô và các vật liệu dùng cho phản ứng khuếch đại PCR được tổng hợp thành kit đang được lưu hành trên thị trường có thành phần phù hợp như dưới đây.

Quá trình pha chế, bảo quản, sử dụng phải tuân thủ theo hướng dẫn của nhà sản xuất. Trong trường hợp sử dụng các vật liệu hoá chất riêng lẻ, độ tinh khiết của các thành phần và nước pha chế phải đảm bảo chất lượng dùng cho vi sinh và sinh học phân tử.

5.2.2.1 Dung dịch đệm pepton

Pepton (C5H10O5): 10,0g

Natri clorua (NaCl): 5,0g

Ðinatri hyđro phôt phat (Na2HPO4): 3,6 g

Kali đihyđro phôt phat (KH2PO4): 1,5g

Nước cất: 1000 ml

Hoà tan các thành phần trong nước cất, đun tan, phân phối vào trong các bình chứa phù hợp. Hấp khử trùng ở nhiệt độ 121oC trong 15 phú. pH sau khi khử trùng là 7,0 0,2 ở 25oC.

5.2.2.2 Hỗn hợp dùng trong khuếch đại PCR 1,1x

Taq polymerase: 0,025 U/ml (1,25 U/50 ml)

Tris – HCl (pH = 8,8 ở nhiệt độ 25oC): 75 mM

Sunphat amon (NH4)2ư SO4: 20 nM

Tween 20: 0,01% (v/v)

dNTP (dATP, dCTP, dGTP, dTTP): 200 mM (mỗi loại)

Magiê clorua (MgCl2) 1,5 mM

Tất cả các thành phần trên được pha chế trong nước cất 2 lần và bảo quản ở nhiệt độ 4oC trong 1 tháng. Có thể bảo quản ở nhiệt độ – 20oC trong 1 năm. Không nên rã đông và tái đông dung dịch đã pha chế nhiều lần.

5.2.2.3 Thang ADN

Nên sử dụng thang đo phù hợp có thể ước lượng được đoạn khuếch đại 520 bp. Có thể sử dụng sản phẩm khuếch đại có kích thước 520 bp đã biết trước làm thang đo trong phương pháp này.

5.2.2.4 Agarose

Sử dụng trong kỹ thuật này là loại dùng để điện di ADN có kích thước nhỏ hơn 1000 bp.

5.2.2.5 Ðệm điện di TAE 1x

Tris: 4,84 g

Na2EDTA 0,5M, pH = 8,0: 2 ml

Axit axetic băng: 1,14 ml

Nước cất cho đủ: 1000 ml

Nên pha chế thành dung dịch 10x (đậm đặc 10 lần), khi sử dụng mới pha loãng với nước thành dung dịch 1x.

5.2.2.6 Ðệm tải mẫu 6x

Glyxerol: 30 %

Xanh bromphenon: 0,25 %

Tris: 200 mM

Na2EDTA: 20 mM

Các thành phần trên được pha trong nước cất, bảo quản ở nhiệt độ 4oC.

5.2.2.7 Thuốc nhuộm AND: dung dịch etyl bromua nồng độ 10 mg/ml

6. Phương pháp tiến hành

6.1 Lấy mẫu

Cân chính xác 25 g mẫu (hoặc một khối lượng chính xác tuỳ theo yêu cầu) rồi cho vào bình tam giác hoặc bao PE vô trùng.

6.2 Tăng sinh

Nhằm làm tăng số lượng Salmonella trong mẫu, các tế bào bị suy yếu hay tổn thương cũng được phục hồi và phát triển. Giai đoạn này được tiến hành trong môi trường không chọn lọc và trên nguyên tắc cứ một phần khối lượng mẫu sẽ bổ sung 9 phần khối lượng môi trường tăng sinh. Nếu lấy 25 g mẫu, phải bổ sung 225 g môi trường tăng sinh dung dịch pepton đệm.

ủ mẫu có môi trường tăng sinh ở nhiệt độ 37,0oC 1,0oC trong khoảng 18 giờ 2 giờ.

6.3 Xử lý mẫu giải phóng ADN

Giai đoạn này nhằm thu nhận sinh khối sau khi tăng sinh, rửa sạch môi trường sau khi nuôi cấy, phá vỡ tế bào để giải phóng ADN. Cách xử lý như sau:

6.3.1 Lắc đều canh khuẩn tăng sinh. Hút 0,5 ml vào trong ống eppendorf có thể tích 1,5 ml, ly tâm với tốc độ 10 000 vòng/phút trong 5 phút rồi loại bỏ phần môi trường lỏng bên trên. Rửa sinh khối bên dưới với nước cất vô trùng rồi tiếp tục ly tâm với chế độ như trên để loại bỏ phần nước.

6.3.2 Huyền phù sinh khối trong ống với 0,5 ml nước cất vô trùng. Ðun sôi cách thuỷ trong 10 phút. Ly tâm huyền dịch sau khi đun với tốc độ 10 000 vòng/phút trong 5 phút để lắng các mảnh vỡ tế bào xuống đáy. Phần dịch trong bên trên được coi là khuôn ADN để tiến hành phản ứng khuếch đại.

6.4 Khuếch đại

Giai đoạn này nhằm làm tăng số lượng bản sao đoạn ADN đích trên máy luân nhiệt (thermocycler) bằng hai mồi đặc trưng. Quá trình khuếch đại được tiến hành trong khoảng 30 chu kỳ.

6.4.1 Chuẩn bị ống khuếch đại

Hút 45 ml hỗn hợp khuếch đại PCR 1,1 x cho vào trong ống nghiệm PCR có thể tích 0,2 hoặc 0,5 ml, thêm vào 1 ml mỗi mồi invA1 và invA2 có nồng độ 6 pM và 3 ml mẫu khuôn ADN. Tổng thể tích trong một ống khuếch đại là 50 ml.

Ðối chứng dương: thay dịch khuôn ADN mẫu bằng dịch ADN của Salmonella chuẩn đã biết.

Ðối chứng âm: thay dịch khuôn ADN mẫu bằng nước cất vô trùng.

6.4.2 Chương trình khuếch đại

Các ống khuếch đại được đặt vào trong máy luân nhiệt. Chương trình khuếch đại như sau:

Duy trì nhiệt độ 95oC trong 5 phút để làm biến tính hoàn toàn các sợi ADN trong mẫu. Tiếp theo là 35 chu kỳ, mỗi chu kỳ có 3 bước như sau: 95oC/60 giây; 54oC/45 giây và 72oC/60 giây. Sau khi kết thúc 35 chu kỳ, mẫu được giữ ở nhiệt độ 72oC trong 10 phút, sau đó giữ ổn định ở nhiệt độ 20oC cho đến khi điện di.

6.5 Ðiện di sản phẩm khuếch đại

6.5.1 Chuẩn bị gel điện di agarose 1%

Gel agarose 1 % pha trong đệm TAE 1x được đun chảy hoàn toàn và đổ vào khay điện di đã có sẵn các lược để tạo giếng. Gel điện di phải có độ dày khoảng 3 – 4 mm. Gel sau khi chuẩn bị được ngâm chìm hoàn toàn trong đệm TAE.

6.5.2 Chuẩn bị dịch điện di

Mẫu sau khi khuếch đại được nhuộm với 10 ml đệm tải mẫu 6x rồi trộn thật đều.

6.5.3 Ðiện di

Một giếng trong gel điện di được sử dụng cho thang ADN chuẩn hay mẫu đối chứng dương. Nạp 10 ml dịch điện di đã chuẩn bị vào trong gel agarose. Tiến hành điện di trong 60 phút ở hiệu điện thế 100 vôn.

6.6 Nhuộm ADN, quan sát sản phẩm khuếch đại

6.6.1 Chuẩn bị dung dịch nhuộm mẫu

Pha dung dịch nhuộm ADN như sau: cho 0,2 ml etyl bromua 10 mg/ml vào 0,5 lít nước, pha vào trong khay chứa có miệng rộng hơn bản gel điện di.

6.6.2 Nhuộm gel

Ngâm bản gel đã điện di vào dung dịch nhuộm trong 10 phút. Rửa gel bằng nước trong khoảng 3 – 5 phút để loại bỏ phần etyl bromua dư.

6.6.3 Quan sát, chụp hình

Cho bản gel đã nhuộm lên hộp đèn soi UV, đóng kính bảo vệ, bật đèn rồi quan sát các vạch sáng đỏ của ADN xuất hiện trên bản gel. Sau đó, chụp hình để lưu trữ kết quả.

7. Ðọc và giải thích kết quả

Kết quả phân tích chỉ được xem xét kết luận khi mẫu đối chứng dương tính có sản phẩm khuếch đại ADN với kích tước 520 bp và mẫu đối chứng âm không có sản phẩm này.

Mẫu được kết luạn là dương tính Salmonella khi có sản phẩm khuếch đại 520 bp trên bản gel. Mẫu được kết luận là âm tính khi không có sản phẩm khuếch đại, hay sản phẩm khuếch đại có kích thước khác hơn 520 bp.

8. Qui định về đảm bảo an toàn

Trong quá trình tiến hành thao tác phải thực hiện đúng các qui định sau đây:

8.1 Thuốc nhuộm etyl bromua là một chất độc có thể gây ung thư cho người và động vật. Do đó, khi sử dụng hoá chất này phải có găng tay và kính bảo hộ. Dung dịch sau khi sử dụng phải cho chảy qua than hoạt tính trước khi đổ bỏ.

8.2 Chỉ được bật đèn UV để quan sát ADN sau khi đã đóng kính bảo vệ.

8.3 Nghiêm cấm sử dụng các dụng cụ liên quan đến sản phẩm sau khuếch đại cho việc tăng sinh hay chuẩn bị mẫu.

8.4 Phòng thí nghiệm phải được bố trí riêng biệt khu chuẩn bị mẫu trước khi khuếch đại và khu xử lý sản phẩm sau khi khuếch đại để tránh hiện tượng nhiễm chéo gây kết quả dương tính giả.

Bài viết khác

Kiểm nghiệm Tổng số vi sinh vật hiếu khí

Kiểm nghiệm Tổng số vi sinh vật hiếu khí

Nguyên tắc: Tổng vi sinh vật hiếu được đếm bằng cách đổ và ủ trong điều kiện hiếu khí ở 300C/72±6 giờ